Share on

Molecular characterization of Yersinia enterocolitica strains to evaluate virulence associated genes

Authors

Abstract

Introduction. Yersinia enterocolitica (Ye) species is divided into 6 biotypes (BT), 1A, 1B, 2, 3, 4, 5 classified based on biochemical reactions and about 70 serotypes, classified based on the structure of the lipopolysaccharide O-antigen. The BT1A is considered non-pathogenic, while the BT 1B-5 are considered pathogenic.
Methods. Evaluate the distribution of eleven chromosomal and plasmid virulence genes, ail, ystA, ystB, myfA, hreP, fes, fepD, ymoA, sat, virF and yadA, in 87 Ye strains isolated from food, animals and humans, using two SYBR Green real-time PCR platforms.
Results. The main results showed the presence of the ail and ystA genes in all the pathogenic bioserotypes analyzed. The ystB, on the other hand, was identified in all non-pathogenic strains biotype 1A. The target fes, fepD, sat and hreP were found in both pathogenic biotypes and in BT1A strains. The myfA gene was found in all pathogenic biotype and in
some Ye BT1A strains. The virF and yadA plasmid genes were mainly detected in bioserotype 4/O:3 and 2/O:9, while ymoA was identified in all strains.
Conclusions. The two molecular platforms could be used to better define some specific molecular targets for the characterization and rapid detection of Ye in different sources which important implications for food safety and animal and human health.

INTRODUCTION

The genus Yersinia has been recently classified to Yersiniaceae family [1] and comprises of 28 species (https://lpsn.dsmz.de/genus/yersinia), three of which are pathogenic to humans Y. pestis, Y. enterocolitica and Y. pseudotuberculosis [2]. Yersinia enterocolitica (Ye) is Gram-negative and psychrophilic enteropathogen [3]. In fact, Ye has an optimal growth temperature between 28-30 °C but is able to growth from 2 and 42 °C [4]. Yersiniosis is usually a self-limiting disease and gastrointestinal symptoms pre-dominate, but extra-intestinal disorders may also appear [5]. Children under 5 years of age, immunocompromised people, and elderly are more likely to get sick and to have a more serious illness [4].

In Europe, yersiniosis is the third most frequently reported foodborne zoonosis in humans with a stable trend in 2015-2019 [6]. In Italy the number of reported cases is very low compared with other EU/EEA member states, because the notification of yersiniosis is voluntary, and the number of cases is probably underestimated [7].

Ye is widely distributed in the environment and pigs are the main reservoir of pathogenic strains, in particular, the bacterium colonized tonsils, lymph nodes and intestines. Ye is also isolated from other animals, such as cattle, small ruminants, wild animals (e.g., deer) and pets (cats and dogs) [8, 9]. Humans become infected by ingesting undercooked pork contaminated with Ye, but also milk and dairy products, vegetables and untreated water [10, 11]. Although pork meat is the major source of pathogenic Ye, in recent years, fresh vegetables have been linked to several foodborne outbreaks, particularly spinach and salad [12, 13]. The Ye species is highly heterogeneous and is divided into 6 biotypes (BT), 1A, 1B, 2, 3, 4, 5, on the basis of biochemical tests and about 70 serotypes [14]. The biotypes show differing pathogenic potential, in particular: biotype 1A (BT1A) is considered non-pathogenic, biotypes 2-5 weakly pathogenic, and biotype 1B highly pathogenic [15]. Pathogenic Ye have historically been defined as carriers of a 70 kb virulence plasmid (pYV), which has genes encoding adhesin A (yadA) and a transcriptional regulator gene (virF); in addition, at the chromosomal level they harbour virulence genes as invA (invasin), ail (attachment and invasion locus), ystA (stable Yersinia toxin A), and myfA (mucoid Yersinia factor A) [16].

BT1A strains are considered non-pathogenic because they do not have the pYV and some chromosomal virulence genes such as ail. However, studies have shown that some biotype 1A strains, particularly those isolated from faeces during a gastrointestinal illness, could be pathogenic [17]. Although BT1A may lack the pYV plasmid, alternative virulence factors, including the thermostable toxin ystB and hreP [18] may be present. BT1A is the most heterogeneous of the six Ye biotypes and includes a wide range of serotypes of which O:5, O:6,30, O:6,31, O:7,8, O:10, as well as not-typable (NT) O strains, are most often reported [19]. The most common bioserotypes causing human yersiniosis in Europe are Ye 4/O:3 and 2/O:9 [6].

ISO 10273 (International Organization for Standardization) standard cultural method for the detection and isolation of Ye from food samples are laborious and time-consuming to differentiate pathogenic and non-pathogenic strains [20, 21].

To meet the requirement for faster analysis, ISO approved a standard method for rapid identification of pathogenic Ye based on detection of the chromosome-localized ail gene which is present in all pathogenic bioserotype by real-time PCR [22]. However, recent studies have indicated that in some non-pathogenic 1A strains of Ye, the ail gene can be detected [23]. Therefore, it would be useful to consider other pathogenicity targets of the strains to have a more complete genomic characterisation. Recently, a study analyzed by real-time PCR the distribution of the yadA, virF, inv, ystA, ystB, myfA, hreP and ymoA genes in Ye strains in order to select useful target genes for assessing the presence of pathogenic Ye [18].

The aim of the present study is to extend the examination of the distribution of virulence genes in non-pathogenic and pathogenic Ye strains, isolated from animal, food and human samples. Additional molecular targets would allow for a more complete characterization of Ye strains, and the evaluation of the distribution of these genes which have virulence potential and are less investigated.

Thus, besides the virulence genes ail, ystA, ystB, myfA, virF and yadA, the other target genes analyzed are: hreP (host reactive element), sat (streptogramin acetyltransferase), fepD (enterochelin transporter ABC), fes (enterochelin esterase) and ymoA (Yersinia modulating protein) [24], using two molecular real-time PCR SYBR Green platforms.

MATERIALS AND METHODS

Identification and typing of bacterial strains

A total of 87 Ye strains, 82 isolates from 2005 to 2015 and 5 isolates from 1980 to 1985 in Italy, were identified at biochemical level and subsequently biotyped and serotyped. These strains were isolated from human (n=39), in particular stools (n=24), blood (n=3), appendix (n=1) and unknown (n=11), from animals (n=12), in particular faeces (n=7), amygdala (n=2) and unknown (n=3) and from food (n=36).

Identification of Ye species was performed using the API® 20E system (bioMérieux). Ye biotyping was carried out according to the ISO 10273 scheme, based on biochemical reactions, in particular: pyrazinamidase and lipase activity, production of indole, production of acids from xylose, trehalose and hydrolysis of esculin. Serotyping was performed using O-antisera for serogroups O:3, O:5, O:8, O:9 and O:27 purchased from Biolife (Biolife Italiana, Milan, Italy).

Genomic DNA extraction

The strains were grown in Tryptone Soy Broth (Biolife Italiana, Milan, Italy) at 30 °C for 24-48h. Two mL of each broth culture was subjected to DNA extraction according to the protocol of Peruzy et al. [18]. The extracted DNA was used as a template for real-time PCR.

Real-time PCR-based protocol

For the molecular characterization of Ye virulence genes, two SYBR Green real-time PCR platforms were developed with two different thermal profile. The first platform, a PCR reaction in singleplex, containing: 1X SsoAdvanced SYBR Green PCR Master Mix (Bio-Rad), one of the primer (Table 1) at different concentrations, of the virulence genes ail (250 nM), ystA (100 nM), ystB (150 nM), myfA (300 nM) and 3 μl of DNA in a final volume of 25 μl. The thermal profile was: 95 °C for 5 min, 35 cycles at 95 °C for 10 s and 60 °C for 30 s, followed by a thermal cycle (65-95 °C) necessary for the analysis of the melting curve. The second platform, a PCR reaction in singleplex, containing: 1X SsoAdvanced SYBR Green PCR Master Mix (Bio-Rad, USA), one of the primer (Table 1), at different concentrations, of the virulence genes hreP (300 nM), and 250 nM of the other virulence genes virF, yadA, ymoA, fes, fepD, and sat and 3 μl of DNA in a final volume of 25 μl. The thermal profile of the reaction was: 95 °C for 5 min, 35 cycles at 95 °C for 60 s, 60 °C for 60 s, 72 °C for 60 s, followed by a thermal cycle (65-95 °C) necessary for the analysis of the melting curve. The specificity of the reaction is given by the detection of the melting temperature (Tm) of the amplification products after the last reaction cycle. The melting curve was visualized with the software MxPro (Mx3005P v 4.00 - Agilent).

RESULTS

The results obtained of serotyping and biotyping of the 87 Ye strains have identified four biotypes and several serotype: 1A/O:5 (n=15), 1A/O:8 (n=9), 1A/NT (n=25), 2/O:9 (n=5); 3/O:5,27 (n=1); 4/O:3 (n=32). The results obtained analysing these strains through SYBR Green real-time PCR showed a close association between the ail gene, considered an exclusive indicator of pathogenicity, and the ystA gene as they were found in all strains belonging to the pathogenic biotypes (Table 2). In contrast, ystB was found exclusively in all non-pathogenic biotype 1A strains. The presence of the virF and yadA plasmid genes appears to be exclusive to pathogenic biotypes, found in 42.1% (n=16) of the total of the pathogenic strains (Table 2).

The myfA gene was detected in all pathogenic strains (n=38), but also in 3 strains of BT1A strains (6.1%). The fes and fepD genes, which encode for factors capable of capturing and utilizing host iron, were found in synergy with each other in both pathogenic and non-pathogenic biotypes. The hreP and sat genes appear present in high percentages in all biotypes analyzed, as is the ymoA gene, which is present in 100% of strains (Table 2). The distribution of bioserotypes showed the prevalence of 4/O:3 and 2/O:9 mainly in human samples, and 4 of 32 strains of Ye 4/O:3 were found in pigs, whereas BT1A was found mainly in a wide variety of food samples, but also, less frequently, in animals and humans (Table 3).

DISCUSSION

The results showed a non-uniform distribution of the different target genes in the various Ye strains. Chromosomal virulence genes are very important elements that determine the pathogenic capabilities of Ye. These include the attachment invasion locus (ail), which encodes the outer membrane proteins responsible for adhesion, and is considered the target gene for detection of pathogenic Ye according to ISO/TS 18867:2015.

Furthermore, Ye has the ability to produce three types of YstI toxins (YstA, YstB and YstC) encoded by ystA, ystB and ystC genes, respectively, which play a crucial role in the origin of diarrhea [31]. As expected, all strains belonging to pathogenic biotypes, analyzed in this work, contain the ail gene together with the ystA gene. Ye BT1A mainly produce the enterotoxin YstB and rarely YstC. The ability of some BT1A strains to cause illness gives indirect evidence that YstB plays an important role in yersiniosis, as suggested in some studies [31, 32]. Indeed, in the present study the ystB was detected in 100% of BT1A strains, results in agreement with literature data [24, 33].

The pYV plasmid undoubtedly plays an important role in pathogenicity and carry virulence factors, such as virF, a regulatory gene, which encodes the transcriptional activator of several genes, including the plasmid virulence gene yadA involved in the Yersinia invasion process. However, plasmids are unstable structures, and Ye BT1A generally do not harbour plasmids [31, 34].

The results reported in our study confirm that plasmid virulence genes are not present in any strain belonging to the non-pathogenic biotype (BT1A), whereas they are found in about 42.1% of the total pathogenic biotypes, with a different distribution between bioserotype 4/O:3 where plasmid genes are present in 40.1% and bioserotype 2/O:9 where virF and yadA are present in 60%.

MyfA, plays an important role at the beginning of infection by promoting adhesion to enterocytes. The myfA gene has been found in Ye strains of bioserotype 4/O:3 isolated from human and pigs [33] and has also been detected in some Ye strains of BT1A [24].

These results are confirmed in this study, and we also found myfA in all strains of bioserotype 2/O:9 isolated from human and in the only strain belonging to bioserotype 3/O:5,27 isolated from animal.

The ymoA gene was present in all Ye isolates studied, as reported in several studies [18, 24, 33]. According to recent studies, the ymoA gene is the main regulator of yst gene expression and other virulence genes [34].

The hreP gene, which encodes the bacterial subtilisin/Kexin-like protease, and the sat gene, which encodes the acetyltransferase streptogramin, are both present in high percentage in all Ye strains. These results are in agreement with data from some other Authors [18, 24], but seem to be in contrast with data reported by Morka et al. [33]. Few studies have described the hreP gene, encoding for a bacterial protease, relevant for full virulence of Ye [35]. Finally, the fes and fepD genes, involved in iron capture and utilization, contribute to the growth of microorganism [30].

The genes fepD and fes were found in 100% or percentage near 100% in all isolates of all bioserotypes except for BT4/O:3 where the prevalence of these genes was about 44%. BT1A strains possessing the genes ystB, hreP, sat, fes, fepD and myfA genes may have a virulence potential with respect to causing infections in humans and animals [24, 36]. Although in the study of Campioni and Falcão [36], myfA appears to have a higher prevalence in the BT1A strains (55%) than in our study.

Furthermore, the lack of identification of BT1B strains in this work, appears to be in line with what has been reported in the literature regarding the limited presence or absence of this biotype in Europe [4, 6].

Overall, the study seems to confirm what other authors have already pointed out regarding the distribution of these virulence genes in Ye strains.

CONCLUSIONS

The isolation and biotyping of Ye are currently difficult and time-consuming, but biotyping remains important as a basis for assessing the pathogenicity of isolated strains. The detection of this microorganism by means of molecular biology tools as a real-time PCR allows the quick detection of pathogenic Ye in food, animal and human and can be a valid support to classical microbiology techniques. Although, the ail gene remains the main virulence marker as reported by ISO/TS 18867:2015, other virulence genes are important in evaluating the pathogenicity of Ye, such as the ystB gene to identify strains of biotype 1A. Therefore, the use of two SYBR Green real-time PCR platforms in this study, allowed the rapid detection of the eleven virulence genes, in pathogenic biotypes and in BT1A of Ye. It also allowed to highlight a diversity in the distribution of virulence genes in Ye strains isolated from different sources, which has valuable implications in terms of food safety and animal and human health from a One Health perspective.

Other Information

Authors’ contributions

Conceptualization: ED and EV; methodology: ED; investigation: ED, EV, SF, SL, GF, SB and SO; resources: ED, SF, SL, GF, SB and SO; writing-original draft preparation: EV and ED; writing-review and editing: ED, SF, SL, GF, SB; supervision: ED. All authors have read and agreed to the published version of the manuscript.

Conflict of interest statement

The Authors declare no conflict of interest.

Address for correspondence: Elisabetta Delibato, Dipartimento di Sicurezza Alimentare, Nutrizione e Sanità Pubblica Veterinaria, Istituto Superiore di Sanità, Viale Regina Elena 299, 00161 Rome, Italy. E-mail: elisabetta.delibato@iss.it

Figures and tables

Gene Primer sequence (5’->3’) Amplicon size (bp) Reference
ail ACTCGATGATAACTGGGGAG 170 [25]
CCCCCAGTAATCCATAAAGG
ystA ATCGACACCAATAACCGCTGAG 79 [26]
CCAATCACTACTGACTTCGGCT
ystB GTACATTAGGCCAAGAGACG 146 [26]
GCAACATACCTCACAACACC
myfA CAGATACACCTGCCTTCCATCT 272 [27]
CTCGACATATTCCTCAACACGC
hreP GCCGCTATGGTGCCTCTGGTGTG 757 [24]
CCCGCATTGACTCGCCCGTATC
virF GGCAGAACAGCAGTCAGACATA 591 [25]
GGTGAGCATAGAGAATACGTCG
yadA TAAGATCAGTGTCTCTGCGGC 747 [28]
TAGTTATTTGCGATCCCTAGCAC
ymoA GACTTTTCTCAGGGGAATAC 330 [29]
GCTCAACGTTGTGTGTCT
fes GCCGGCAGGCACAGCGTAAT 561 [30]
GGCCAACCCACCCAAAACTT
fepD GTGTGATTGCCTTACTATTG 381 [30]
CGGTCATCCTTTTATTACGG
sat CCGATGGTGGGGTTTTCTCAAG 456 [24]
GGGATTACCGCCGACCACACTA
Table 1. Primers used for SYBR Green real-time PCR
Biotype/serotype (n) ail ystA ystB myfA hreP virF yadA fepD fes ymoA sat
4/O:3(32) 100% 100% - 100% 100% 40.1% 40.1% 43.8% 43.8% 100% 96.8%
2/O:9(5) 100% 100% - 100% 100% 60.0% 60.0% 100% 100% 100% 100%
3/O:5.27(1) 100% 100% - 100% 100% - - 100% 100% 100% 100%
1A/NT (25) - - 100% 12.0% 72.0% - - 96.0% 96.0% 100% 84.0%
1A/O:5(15) - - 100% - 93.3% - - 100% 100% 100% 100%
1A/O:8(9) - - 100% - 100% - - 100% 100% 100% 100%
Table 2. The distribution of genes in Ye strains grouped by biotype/serotype
Source (n) Specific source BT1A BT2 BT3 BT4
Animals (12) Bear 1
Bovine 1
Sheep 1 1
Swine 4 4
Food (36) Beef 1
Chicken meat 4
Fish 2
Fresh vegetables 2
Milk 1
Minced meat of beef and pork 3
Pork meat 8
Ready to eat pork meat 2
Ready to eat vegetables 12
Sheep meat 1
Humans (39) Humans 6 5 28
Table 3. The distribution of different sources (food, animals and human) in Yersinia enterocolitica biotypes (BT)

References

  1. Adeolu M, Alnajar S, Naushad S, Gupta R. Genome-based phylogeny and taxonomy of the ‘Enterobacteriales’: proposal for Enterobacterales ord. nov. divided into the families Enterobacteriaceae, Erwiniaceae fam. nov., Pectobacteriaceae fam. nov., Yersiniaceae fam. nov., Hafniaceae fam. nov., Morganellaceae fam. nov., and Budviciaceae fam. nov. Int J Syst Evol Microbiol. 2016;66(12):5575-99.
  2. Hammerl J, Barac A, Erben P, Fuhrmann J, Gadicherla A, Kumsteller F, Lauckner A, Müller F, Hertwig S. Properties of two broad host range phages of Yersinia enterocolitica isolated from wild animals. Int J Mol Sci. 2021;22.
  3. Gill C, Reichel M. Growth of the cold-tolerant pathogens Yersinia enterocolitica, Aeromonas hydrophila and Listeria monocytogenes on high-pH beef packaged under vacuum or carbon dioxide. Food Microbiol. 1989;6:223-30.
  4. Bari M, Hossain M, Isshiki K, Ukuku D. Behavior of Yersinia enterocolitica in Foods. J Pathog. 2011;2011.
  5. Rodio D, Bressan A, Ambrosi C, Scribano D, Tolli R, Mansour W, Speziale F, Antonelli G, Trancassini M, Pietropaolo V. Yersinia enterocolitica in Italy: A case of septicemia and abdominal aortic aneurysm infection. Front Med (Lausanne). 2018;5.
  6. The European Union One Health 2020 Zoonoses Report. EFSA J. 2021;19(12).
  7. In: ECDC. Annual epidemiological report for 2019. Stockholm: ECDC; 2021.
  8. Rakin A, Garzetti D, Bouabe H, Sprague L. Molecular medical microbiology. Tang Y-W, Sussman M, Liu D, Poxton I, Schwartzman J, editors. London: Academic Press; 2015.
  9. Ye Q, Wu Q, Hu H, Zhang J, Huang H. Prevalence and characterization of Yersinia enterocolitica isolated from retail foods in China. Food Control. 2016;61:20-7.
  10. Chlebicz A, Śliz˙ewska K. Campylobacteriosis, salmonellosis, yersiniosis, and listeriosis as zoonotic foodborne diseases: A review. Int J Environ Res Public Health. 2018;15(5).
  11. Shoaib M, Shehzad A, Raza H, Niazi S, Khan I, Akhtar W, Safdar W, Wang Z. A comprehensive review on the prevalence, pathogenesis and detection of Yersinia enterocolitica. RSC Adv. 2019;70:41010-21.
  12. Espenhain L, Riess M, Müller L, Colombe S, Ethelberg S, Litrup E, Jernberg C, Kühlmann-Berenzon S, Lindblad M, Hove N, Torpdahl M, Mörk M. Cross-border outbreak of Yersinia enterocolitica O3 associated with imported fresh spinach, Sweden and Denmark, March 2019. Euro Surveill. 2019;24.
  13. MacDonald E, Einöder-Moreno M, Borgen K, Thorstensen Brandal L, Diab L, Fossli Ø, Guzman Herrador B, Hassan A, Johannessen G, Johansen E, Jørgensen Kimo R, Lier T, Paulsen B, Popescu R, Tokle Schytte C, Sæbø Pettersen K, Vold L, Ørmen Ø, Wester A, Wiklund M, Nygård K. National outbreak of Yersinia enterocolitica infections in military and civilian populations associated with consumption of mixed salad, Norway, 2014. Euro Surveill. 2016;21.
  14. Fredriksson-Ahomaa M. In: Foodborne diseases. London: Elsevier, Academic Press; 2017.
  15. Reuter S, Connor T, Barquist L, Walker D, Feltwell T, Harris S, Fookes M, Hall M, Petty N, Fuchs T, Corander J, Dufour M, Ringwood T, Savin C, Bouchier C, Martin L, Miettinen M, Shubin M, Riehm J, Laukkanen-Ninios R, Sihvonen L, Siitonen A, Skurnik M, Falcão J, Fukushima H, Scholz H, Prentice M, Wren B, Parkhill J, Carniel E, Achtman M, McNally A, Thomson N. Parallel independent evolution of pathogenicity within the genus Yersinia. Proc Natl Acad Sci USA. 2014;18:6768-73.
  16. Rivas L, Strydom H, Paine S, Wang J, Wright J. Yersiniosis in New Zealand. Pathogens. 2021;10.
  17. Bhagat N, Virdi J. The enigma of Yersinia enterocolitica biovar 1A. Crit Rev Microbiol. 2011;37(1):25-39.
  18. Peruzy M, Murru N, Perugini A, Capuano F, Delibato E, Mercogliano R, Korkeala H, Proroga Y. Evaluation of virulence genes in Yersinia enterocolitica strains using SYBR Green real-time PCR. Food Microbiol. 2017;65:231-5.
  19. Tennant S, Grant T, Robins-Browne R. Pathogenicity of Yersinia enterocolitica biotype 1A. FEMS Immunol Med Microbiol. 2003;38:127-37.
  20. Microbiology of the food chain - Horizontal method for the detection of pathogenic Yersinia enterocolitica. Geneva: International Organization for Standardization; 2017.
  21. Fredriksson-Ahomaa M, Joutsen S, Laukkanen-Ninios R. Identification of Yersinia at the species and subspecies levels is challenging. Curr Clin Microbiol Rep. 2018;5:135-42.
  22. Microbiology of the food chain - Polymerase chain reaction (PCR) for the detection of food-borne pathogens - Detection of pathogenic Yersinia enterocolitica and Yersinia pseudotuberculosis. Geneva: International Organization for Standardization; 2015.
  23. Joutsen S, Johansson P, Laukkanen-Ninios R, Björkroth J, Fredriksson-Ahomaa M. Two copies of the ail gene found in Yersinia enterocolitica and Yersinia kristensenii. Vet Microbiol. 2020;247.
  24. Bhagat N, Virdi J. Distribution of virulence-associated genes in Yersinia enterocolitica biovar 1A correlates with clonal groups and not the source of isolation. FEMS Microbiol Lett. 2007;266:177-83.
  25. Bhaduri S, Cottrell B, Pickard A. Use of a single procedure for selective enrichment, isolation, and identification of plasmid-bearing virulent Yersinia enterocolitica of various serotypes from pork samples. Appl Environ Microbiol. 1997;63:1657-60.
  26. Thoerner P, Bin Kingombe C, Bögli-Stuber K, Bissig-Choisat B, Wassenaar T, Frey J, Jemmi T. PCR detection of virulence genes in Yersinia enterocolitica and Yersinia pseudotuberculosis and investigation of virulence gene distribution. Appl Environ Microbiol. 2003;69:1810-6.
  27. Kot B, Trafny E. The application of PCR to the identification of selected virulence markers of Yersinia genus. Pol J Vet Sci. 2004;7:27-31.
  28. Estrada C, Velázquez L, Favier G, Genaro M, Escudero M. Detection of Yersinia spp. in meat products by enrichment culture, immunomagnetic separation and nested PCR. Food Microbiol. 2012;30:157-63.
  29. Grant T, Bennett-Wood V, Robins-Browne R. Identification of virulence-associated characteristics in clinical isolates of Yersinia enterocolitica lacking classical virulence markers. Infect Immun. 1998;66:1113-20.
  30. Schubert S, Fischer D, Heesemann J. Ferric enterochelin transport in Yersinia enterocolitica: molecular and evolutionary aspects. J Bacteriol. 1999;181:6387-95.
  31. Platt-Samoraj A. Toxigenic properties of Yersinia enterocolitica biotype 1A. Toxins (Basel). 2022;14.
  32. Singh I, Virdi J. Production of Yersinia stable toxin (YST) and distribution of yst genes in biotype 1A strains of Yersinia enterocolitica. J Med Microbiol. 2004;53:1065-8.
  33. Morka K, Wałecka-Zacharska E, Schubert J, Dudek B, Woźniak-Biel A, Kuczkowski M, Wieliczko A, Bystroń J, Bania J, Bugla-Płoskońska G. Genetic diversity and distribution of virulence-associated genes in Y. enterocolitica and Y. enterocolitica-like isolates from humans and animals in Poland. Pathogens. 2021;10.
  34. Bancerz-Kisiel A, Pieczywek M, Łada P, Szweda W. The most important virulence markers of Yersinia enterocolitica and their role during infection. Genes (Basel). 2018;9.
  35. Young G, Miller V. Identification of novel chromosomal loci affecting Yersinia enterocolitica pathogenesis. Mol Microbiol. 1997;25:319-28.
  36. Campioni F, Falcão J. Genotypic diversity and virulence markers of Yersinia enterocolitica biotype 1A strains isolated from clinical and non-clinical origins. APMIS. 2014;122:215-22.

Downloads

Authors

Elisabetta Delibato - Istituto Superiore di Sanità

Eleonora Ventola - Istituto Superiore di Sanità

Sarah Lovari

Silvana Farneti

Guido Finazzi

Slawomir Owczarek

Bilei Stefano

How to Cite
Delibato, E., Ventola, E., Lovari, S. ., Farneti, S. ., Finazzi, G., Owczarek, S. ., & Stefano, B. (2023). Molecular characterization of Yersinia enterocolitica strains to evaluate virulence associated genes. Annali dell’Istituto Superiore Di Sanità, 59(4), 280–285. https://doi.org/10.4415/ANN_23_04_07
  • Abstract viewed - 433 times
  • pdf downloaded - 163 times
  • pdf downloaded - 13 times