Share on

Regulation of gene transcription in Escherichia coli O157:H7 in response to a natural derivate peptide of Esculentin-1a used in combination with essential oils from plants of the Cymbopogon genus.

Authors

Abstract

Introduction. We analyzed the expression of several genes implicated in the pathogenicity of Escherichia coli O157:H7, treating bacteria with Esc(1-21), a derivative of peptide esculentin-1 in combination with three essential oils obtained from plants from the Cympopogon genus.
Methods. We used the checkerboard assay to determine the antimicrobial activity of the combinations. We analyzed the expression of some genes implicated in the pathogenicity and quorum sensing system of E. coli O157:H7 by real-time RT-PCR technique.
Results. Treatment of the bacteria with the peptide combined with oils had an efficacious antimicrobial activity. The analysis of gene expression showed that all used combinations regulate positively the espAD and ler genes, located in the pathogenicity island, named the locus of enterocyte effacement. None of the combinations affects the quorum sensing genes: lsrABCFKR and qseBC.
Conclusions. This study demonstrates that the use of essential oil/peptide combinations can be effective in fighting microbial infections.

INTRODUCTION

The development and spread of antibiotic resistance is currently one of the main causes of death worldwide. This has induced considerable efforts in the research for new antimicrobial agents, finding, in the use of essential oils (EOs) and natural peptides, a new weapon in the fight against drug resistance and in the synergistic interactions of drugs a novel strategy.

The human enterohemorrhagic Escherichia coli (EHEC) O157:H7 is a pathogen that causes food-borne infections and the absence of an effective therapy, to counteract its pathogenicity, makes it an interesting target in the search for new antimicrobial compounds. It is the causative agent of several outbreaks of bloody diarrhea and hemolytic-uremic syndrome throughout the world, as it colonizes the large intestine, causing attaching and effacing (AE) lesions [1]. The genes involved in the formation of the AE lesions are encoded within a chromosomal pathogenicity island named the locus of enterocyte effacement (LEE) [2]. LEE encodes a type III secretion system, an outer membrane protein called intimin, a translocated intimin receptor called Tir, and the proteins EspA, EspD, and EspB secreted by the type III secretion apparatus. EspA forms a filament-like structure, which is essential for early bacterial attachment to epithelial cells. This filament connects the needle of the secretion system to a translocation pore within the plasma membrane of the host cell, which is composed of EspD and EspB; EspB and Tir are translocated into host cells, where Tir serves as a receptor for intimin [3]. Nucleotide sequence analysis of the LEE region of E. coli O157:H7 EDL933 strain revealed the presence of 41 open reading frames, most of which are organized into five polycistronic operons named LEE1 through LEE4 and tir. The Ler protein, encoded by the gene ler of the LEE1 operon, is essential for transcriptional activation of the LEE2, LEE3, and tir operons, which encode many of the protein factors required to produce the attaching and effacing phenotype by EHEC strains on host cells. It has been demonstrated in E. coli O157:H7 that Ler acts as a positive regulator of esp genes expression and that the quorum sensing (QS) system regulates LEE genes [4, 5].

QS is a complex mechanism of cell-to-cell signaling involving the production of hormone-like compounds called autoinducers. Through the accumulation of these autoinducers, the bacteria “sense” their population as well as the population of other bacteria in a given environment. When a concentration threshold is reached the autoinducers will bind to a transcriptional activator, which in turn will activate or repress a series of genes. Gram-negative bacteria usually produce acyl-homoserine lactones as autoinducers: autoinducer-1 and autoinducer-2 (AI-1 and AI-2); AI-2 is found in both gram-positive and-negative bacteria [5]. Two genes participate in the synthesis of AI-2, the luxS and pfs genes [6]. luxS positively controls the expression of lsrACDBEFG operon and the flanking genes lsrR and lsrK, implicated in the AI-2 uptake and modification system [7]. Furthermore, the AI-2 regulates the expression and motility of flagella by the two-component regulatory system QseBC, where QseB is the response regulator and QseC is the sensor kinase [8].

LEE locus and QS signaling systems are considered attractive targets for new antimicrobials because they play an essential role in the pathogenesis of E. coli O157:H7. In this study, we used a combination of Esc(1-21), corresponding to the first 20 amino acids of frog skin-derived peptide esculentin-1a [9], with three EOs of the genus Cymbopogon: Cymbopogon flexuosus (Nees ex Steud.) Will.Watson, Cymbopogon citratus (DC.) Stapf and Cymbopogon martinii (Roxb.) Wats var. motia Burk. In our latest study, we observed that the three combinations, working synergistically, were able to enhance their antimicrobial effect on E. coli O157:H7 [10]. The aim of this work was to extend the study on the effect of these EO/peptide combinations on the expression of some LEE and QS regulated genes. Using RT-PCR technology, we analyzed the expression regulation of ler, espA, and espD genes (locus LEE) and luxS, pfs, lsrABCFKR, and qseBC genes (QS system) in bacteria treated with EO/peptide mixtures.

MATERIALS AND METHODS

Bacteria and growth conditions

In this study, we used the enteropathogen E. coli O157:H7 reference strain EDL933, belonging to our laboratory collection. Bacteria were grown in modified M9 minimal medium (modM9) [11] at a standardized inoculum of 1x106 CFU/ml.

Peptide

The peptide Esc(1-21) used in this study was synthesized and purified as described in Scotti et al. [9], but a different batch was employed.

Essential oils chemical composition

The commercial EOs C. citratus, C. flexuosus and C. martinii, utilized in this study were purchased from Naissance Trading (Swansea, Dyfed UK). The EOs were stored at 4 °C in the dark and the stock solutions at 10% (v/v) were prepared dissolving 50 μl of EO in 450 μl of dilution buffer (10% DMSO, 0.5% Tween 80 in PBS) before use.

Gas chromatography-mass spectrometry (GC-MS) analysis

The chemical composition of the EOs was analyzed by gas chromatography-mass spectrometry (GC-MS), using an Agilent 8890 N chromatograph (GC), equipped with a single quadrupole 5977B mass spectrometer (Santa Clara, California, USA) and an autosampler PAL RTC120 (CTC Analytics AG, Zwingen, Switzerland). The mobile phase was helium (99.999%) whereas the stationary phase was an HP-5MS (30 m x 0.25 mm, 0.1 μm i.d.) capillary column from Agilent. The analytical conditions, including injection, split mode, temperature programme, scan mode, as well as the identification and quantification of components, were the same reported by Scotti R. et al. [11].

Determination of MIC and FIC Index

We determined the minimum inhibitory concentration (MIC) of the peptide Esc(1-21) and the three EOs (C. citratus, C. flexuosus and C. martinii) by the broth microdilution method [11], using a two-fold dilutions of each product. An overnight inoculum was diluted in modM9 at the final concentration of 1x106 CFU/ml in a total volume of 200 μl, in the absence or presence of increasing concentrations of drugs. The concentration of EOs ranged from 0.1 to 6.4% (v/v) and the concentration of the peptide ranged from 1 to 32 μM. Samples were inoculated in triplicate in a 96-well polystyrene plate and incubated at 28 °C with constant agitation for 24 h. The MIC was determined as the lowest concentration of each compound at which no visible growth was observed.

We used the checkerboard technique and the fractional inhibitory concentration (FIC) index to assess the synergy between the peptide and the three EOs. The FIC index of two compounds, A and B, is calculated using the following formula: ΣFIC=FICA+FICB where FICA is obtained by the ratio between the value of MIC of compound A alone and in combination; FICB is obtained correspondingly [10, 12]. We inoculated a 96-well microplate with an overnight culture, in a total volume of 200 μl of modM9 per well, to obtain a final concentration of 1x106 CFU/ml. Each row (x-axis) in the plate contains the same diluted concentration of the antimicrobial compound A, while the concentration in each subsequent row is half this value. Similarly, each column (y-axis) in the plate contains the same diluted concentration of the antimicrobial compound B, while the concentration in each subsequent column is half this value. We incubated the microplate at 28 °C for 24 h. The lowest concentration of compounds in wells with no visible growth was used to calculate the FIC index. Two compounds are defined as synergistic when the FIC index value is less than 0.5 [12].

RNA isolation and quantification of gene expression

We obtained mRNA by bacteria grown in the presence or absence of Esc(1-21) combined with the three EOs as described in an our previous work [9]. Bacteria were inoculated in 8 ml of modM9, at the initial concentration of 1x106 CFU/ml in the presence or absence of a concentration of ¼ FIC for the three EO/peptide mixtures. Cultures were incubated at 28 °C for 24 h with 250 rpm agitation and stabilized with RNA Protect Bacteria Reagent (Qiagen). RNA extraction was performed using Presto mini RNA bacteria kit (Geneaid), DNA contamination was eliminated using DNase I (Epicentre) for 20 min at 37 °C, and RNA was precipitated with 0.7% isopropanol and 0.3 M sodium acetate. RT-PCR was used for quantification of mRNA expression of some genes involved in pathogenesis and QS system. Data were normalized using a 16s rRNA gene as an internal control. The primers used for analyzing genes are listed in Table 1.

Statistics

The assays were performed in triplicate for at least three independent experiments. Data represented average values ± the standard deviations. The significant level was set at P value of 0.05.

RESULTS AND DISCUSSION

In recent years, the rapid emergence of antibiotic resistance in bacteria has induced the development of alternatives to antibiotics. One of these alternatives has been the use of combination therapies, with the employment of drugs that proved to have synergistic potential. In our previous works, we studied the antibacterial activity of EOs extracted by Cymbopogon spp. [11] and the frog derived peptide Esc(1-21) [9].

The components of EOs were determined by gas chromatography-mass spectrometry analysis. The main compounds of the EOs from C. citratus and C. flexuosus were the monoterpene aldehydes neral (33.84 and 33.22%, respectively) and geranial (42.83 and 42.4%, respectively); the main components of EO from C. martinii were the monoterpene alcohol geraniol (81.4%) and its ester geranyl acetate (11.74%). These percentages were slightly different from those previously reported [11] since different batches of EOs were employed.

The MIC values for the single component and FIC indexes for the three EO/peptide combinations were reported in Table 2.

MIC of Esc(1-21) was 8 μM and MIC of EOs ranged from 0.2 to 0.8%. The quantities corresponding to the MICs of the individual components EOs and the peptide were greater than those reported in previous works [9, 11] since different batches of EOs were employed. Furthermore, all FIC values obtained were less than 0.5 indicating their synergistic effect against bacteria, as already demonstrated in our latest work [10]. This translates into a greater effectiveness of the mixtures compared to the individual components, with a reduction in the dosages of the used compounds and their possible toxic effects. In the same work [10] we highlighted how the EOs and the peptide used in combination differently affected the expression of the genes analyzed, indicating that the underlying mechanism of antibacterial activity of the combinations was different compared to when the compounds were used individually. Therefore, this study focused on the analysis of gene expression due to the combined use of EO/peptide, able to produce substantial reductions in MIC values, minimizing negative side effects. However, gene expression due to the use of individual components was not taken into consideration, since it is the combined use of multiple antibacterial agents that represents one of the promising alternatives for the treatment of serious infections.

QS is a cellular mechanism, mediated by autoinducers, that allows bacteria to organize their behavior depending on their density [8]. QS system regulates different pathogenic processes like secretion of virulence factors, biofilm formation and antibiotic sensitivity [13] by producing autoinducers AI. In E. coli the Lsr system is responsible for the detection, uptake and signal transduction of the autoinducer AI-2. The genes luxS and pfs contribute to the AI-2 synthesis and the proteins encoded by genes of lsr operon (lsrACDB) are involved in the transport of AI-2 inside the cell. After AI-2 is phosphorylated by LsrK kinase, it represses the activity of LsrR repressor, with the consequent activation of lsr operon [14]. Creating agents that interfere with the microbial QS signaling systems is considered a novel strategy to develop new antimicrobials because it does not give rise to the emergence of resistance [15]. Since the LEE locus plays an essential role in the pathogenesis of E. coli O157:H7 and is regulated by the QS system, we decided to study the effect of the three EO/peptide combinations on the expression of some LEE and QS regulated genes. For this purpose, we examined the expression profile of some genes implicated in the production and uptake of AI-2 (luxS, pfs, lsrACBF, lsrK, and lsrR), the attaching and effacing phenotype (ler, espA, and espD) and the regulatory system qseBC. Figure 1 showed that luxS was not affected by the treatment with the three EO/peptide combinations, unlike the pfs gene showed a significant increase.

It was also evident that the lsr operon genes, in the presence of the mixtures, were expressed at a similar level to the control, represented by bacteria grown in media modM9. The QS regulator genes qseB and qseC had similar behavior to the lsr operon, with no substantial difference from the control. These results suggested that the QS system was not involved in the response to the treatment with the three combinations and that the induction of the only pfs gene was not enough for the upregulation of this system.

The first gene in the LEE1 operon is ler and, as shown in Figure 1, it was significantly upregulated, 1.8-fold and 1.7-fold, by C. flexuosus EO/Esc(1-21) and C. citratus EO/Esc(1-21), respectively, but it was not by C. martinii EO/Esc(1-21) mixtures. We found that the espA and espD genes (LEE4), involved in bacterial attachment to epithelial cells, were induced by the same two mixtures, following a similar transcription profile of ler. This was in line with what is known from the literature, namely that Ler upregulates esp genes expression [4].

In summary, the three combinations did not induce the QS system. The examined LEE genes had an opposite behavior, showing to be induced by the peptide in combination with EOs from C. flexuosus or C. citratus but not in combination with that from C. martinii that was capable of inducing, in combination with the peptide, only the pfs gene. The observed different effect of the three combinations on LEE genes could be due to the composition of the EOs, which are similar in C. flexuosus and C. citratus, but different in C. martinii. In fact, C. flexuosus and C. citratus have as main components neral and geranial, while geraniol was the main component of C. martinii. However, it is also possible that other minor molecules present in the oils [16] modulate the activity of the major phytocompounds as between factors determining the activity of essential oils there are synergistic interaction of their components. In this regard, to elucidate how the different composition of oils is able to influence their activity, a new study will be carried out to better understand the action of the individual phytocompounds present in the complex mixtures of essential oils.

In conclusion, our results indicated that all EO/Esc(1-21) combinations had an efficacious antimicrobial activity with a synergistic effect on E. coli O157:H7 and suggested a probable mechanism of action of the compounds. Furthermore, these results should be taken into consideration when looking for new treatments capable of inhibiting the QS system and pathogenic processes, to obtain effective antimicrobial and antibiofilm activity. Understanding the mechanisms underlying the antibacterial effect of a synergistic drug combination is therefore critical to finding new and suitable therapy.

Other Information

Conflict of interest statement

The Authors declare no conflict of interest.

Address for correspondence: Roberta Gabbianelli, Servizio Biologico, Istituto Superiore di Sanità, Viale Regina Elena 299, 00161 Rome, Italy. E-mail: roberta.gabbianelli@iss.it

Figures and tables

Figure 1. RT-PCR analysis of expression changes of genes related to production and uptake of AI-2, attaching and effacing phenotype and regulatory system. Relative gene expressions (RQ) represent transcriptional levels after exposure of Escherichia coli O157:H7 EDL933 to mixtures versus untreated control (CTR). The gene transcription level was normalized to that of the reference gene 16s rRNA. Data represent means ± SD of three experiments conducted in triplicate. *P≤0.05.

Oligo name Sequence 5’-3’
For Rev
16s CATCCACAGAACTTTCCAGAG CCAACATTTCACAACACGAG
For Rev
espA CGGCACAAAAGATGGCTAAT ATAGCCGCCTTCACTGTTTG
For Rev
espD AATTGTTGGCCAGGTCTTTG GCTTGCGGCCATAGATATTC
For Rev
ler TCATTGCGGTAGTAAACACCT CAAATTGCAGTTCTACAGCAG
For Rev
lsrA AACATCCTGTTTGGGCTGGCAA AAACAAGCGTTCGGTTTCCGCA
For Rev
lsrB AGCATCCTGGCTGGGAAATTGT AAATTCTTTCACCGTGCCGCG
For Rev
lsrC GCGGGTAACCCTTCAATCCA TCGCGACTTTACTGCTTGGT
For Rev
lsrF CCGGTACCCATTGTTATTGC AGTTCATATGCCCGATCAGC
For Rev
lsrK ACCATCCGTGACTGGAAACC CACCTTCAGACCGCAGAGTT
For Rev
lsrR ATTGGTTTTGGCGAGGCAAC TATAAGAACCGACGCCACCG
For Rev
luxS GGCATCACTTCTTTGTTCGG GCTTCACAGTCGATCATACC
For Rev
pfs TTGAAATTGTGGCAGACATGG GCATTTGGTTATGAATACGGTC
For Rev
qseB GGTTTACACAAGGTCGTCAG ACAGATAATCGTCAGCTCCC
For Rev
qseC GTGGGCGATAAAGATCAATGG GTTCACGACCCAGTAGTACC
Table 1. Primers used in this study for reverse transcription-quantitative polymerase chain reaction
A C. citratus C. flexuosus C. martinii Esc(1-21)
0.40% 0.20% 0.80% 8 μM
B Esc(1-21)+ C. citratus FICI Esc(1-21)+ C. flexuosus FICI Esc(1-21)+ C. martinii FICI
0.5 μM 0.10% 0.312 1 μM 0.05% 0.375 0.5 μM 0.10% 0.187
Table 2. A) Minimal inhibitory concentrations (MIC); B) Fractional inhibitory concentration (FIC) index. The values are expressed in μM for peptide and in percentage (v/v) for oils

References

  1. McDaniel T, Jarvis K, Donnenberg M, Kaper J. A genetic locus of enterocyte effacement conserved among diverse enterobacterial pathogens. Proc Natl Acad Sci USA. 1995;92(5):1664-8.
  2. Beltrametti F, Kresse A, Guzman C. Transcriptional regulation of the esp genes of enterohemorrhagic Escherichia coli. J Bacteriol. 1999;181(11):3409-18.
  3. MacDonald J, Miletic S, Gaildry T, Chin-Fatt A, Menassa R. Co-expression with the Type 3 secretion chaperone CesT from enterohemorrhagic E. coli increases accumulation of recombinant Tir in plant chloroplasts. Front Plant Sci. 2017;8.
  4. Sharma V, Zuerner R. Role of hha and ler in transcriptional regulation of the esp operon of enterohemorrhagic Escherichia coli O157:H7. J Bacteriol. 2004;186(21):7290-301.
  5. Sperandio V, Torres A, Girón J, Kaper J. Quorum sensing is a global regulatory mechanism in enterohemorrhagic Escherichia coli O157:H7. J Bacteriol. 2001;183(17):5187-97.
  6. Beeston A, Surette M. pfs-dependent regulation of autoinducer 2 production in Salmonella enterica serovar Typhimurium. J Bacteriol. 2002;184:3450-6.
  7. Wang L, Li J, March J, Valdes J, Bentley W. luxS-dependent gene regulation in Escherichia coli K-12 revealed by genomic expression profiling. J Bacteriol. 2005;187(24):8350-60.
  8. Sperandio V, Torres A, Kaper J. Quorum sensing Escherichia coli regulators B and C (QseBC): A novel two-component regulatory system involved in the regulation of flagella and motility by quorum sensing in E. coli. Mol Microbiol. 2002;43(3):809-21.
  9. Scotti R, Casciaro B, Stringaro A, Morgia F, Mangoni M, Gabbianelli R. Derivatives of Esculentin-1 peptides as promising candidates for fighting infections from Escherichia coli O157:H7. Antibiotics (Basel). 2022;11(5).
  10. Scotti R, Casciaro B, Stringaro A, Maggi F, Colone M, Gabbianelli R. Fighting microbial infections from Escherichia coli O157:H7: The combined use of three essential oils of the Cymbopogon genus and a derivative of Esculentin-1a peptide. Antibiotics (Basel). 2024;13(1).
  11. Scotti R, Stringaro A, Nicolini L, Zanellato M, Boccia P, Maggi F, Gabbianelli R. Effects of essential oils from Cymbopogon spp. and Cinnamomum verum on biofilm and virulence properties of Escherichia coli O157:H7. Antibiotics (Basel). 2021;10(2).
  12. van Vuuren S, Viljoen A. Plant-based antimicrobial studies-methods and approaches to study the interaction between natural products. Planta Med. 2011;77(11):1168-82.
  13. Bai Y, Shi M, Wang W, Wu L, Bai Y, Li B, Zhou X, Zhang J. Novel quorum sensing inhibitor echinatin as an antibacterial synergist against Escherichia coli. Front Microbiol. 2022;13.
  14. Sharma G, Sharma S, Sharma P, Chandola D, Dang S, Gupta S, Gabrani R. Escherichia coli biofilm: Development and therapeutic strategies. J Appl Microbiol. 2016;121(2):309-19.
  15. Haque M, Islam S, Sheikh M, Dhingra S, Uwambaye P, Labricciosa F, Iskandar K, Charan J, Abukabda A, Jahan D. Quorum sensing: A new prospect for the management of antimicrobial-resistant infectious diseases. Expert Rev Anti Infect Ther. 2021;19(5):571-86.
  16. Bakkali F, Averbeck S, Averbeck D, Idaomar M. Biological effects of essential oils--a review. Food Chem Toxicol. 2008;46(2):446-75.

Downloads

Authors

Raffaella Scotti - Biological Service, Istituto Superiore di sanità

Eleonora Spinozzi - Chemistry Interdisciplinary Project (ChIP) Research Center, School of Pharmacy, University of Camerino, Camerino, Italy

Roberta Gabbianelli

How to Cite
Scotti, R., Spinozzi, E., & Gabbianelli, R. (2024). Regulation of gene transcription in Escherichia coli O157:H7 in response to a natural derivate peptide of Esculentin-1a used in combination with essential oils from plants of the Cymbopogon genus . Annali dell’Istituto Superiore Di Sanità, 60(3), 191–196. https://doi.org/10.4415/ANN_24_03_04
  • Abstract viewed - 534 times
  • PDF downloaded - 107 times